Journal: Nature Communications
Article Title: Neoantigen enriched biomimetic nanovaccine for personalized cancer immunotherapy
doi: 10.1038/s41467-025-59977-8
Figure Lengend Snippet: a Representative histograms showing OVA presentation on WT and B2m −/− B16-OVA cells upon IFN-γ treatment. b The abilities of CM and AECM from WT and B2m −/− B16-OVA cells (2 μg/mL) to stimulate OT-I T-cell proliferation (n = 3 independent experiments/group). c –e B16-OVA tumour growth curves were shown ( c , n = 5 mice/group). At day-29 post tumour inoculation, PBMCs were re-stimulated and the IFN-γ secretion by CD8 + T-cells were determined by ICS ( d , n = 4 mice/group), and tumour infiltrating CD8 + T-cells ( e , n = 4 mice for AECM@PC7A group, n = 5 mice for other groups) were measured. f Representative histograms showing MHC-I expression on WT and B2m −/− MC38 cells upon IFN-γ treatment. MC38 tumour growth curves were shown ( g , n = 5 mice/group). At day-28 post tumour inoculation, the IFN-γ secretion by CD8 + T-cells in PBMCs upon re-stimulation with Adpgk ( h ) or Rpl18 ( i ) neoantigen peptide was determined by ICS, and tumour infiltrating CD8 + T-cells ( j ) were measured (n = 5 mice/group). k B16-OVA tumour-bearing mice were i.t. vaccinated (black arrows), and received i.p. treatment of CD4, CD8 or isotype antibodies. Tumour growth curves were shown (n = 5 mice/group). l – n Splenic DCs were treated with B16-OVA derived nanovaccines (20 μg/mL) for 18 h, and MHC-I acquisitions was determined. Representative scatter plots ( l ) and the levels of acquired MHC-I as calculated by subtracting the MHC-I MFI from that of the untreated cells ( m ) for B2m −/− DCs were shown. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation ( n ) were determined (n = 3 independent experiments/group). o Splenic DCs were treated with indicated PC7A vaccines for 18 h. The treated DCs were harvested and co-cultured with OT-I T-cells for 48 h, CD8 + T-cell proliferation was measured (n = 3 independent experiments/group). p WT or B2m -/- mice were adoptively transferred with 2 × 10 5 OT-I T-cells, followed by s.c. vaccination 18 h later. The percentage of OT-1 CD8 + T-cells (CD8 + OVA Tetramer + ) in spleens was determined (n = 3 mice/group). In ( b – e , g – k , m –p ), q representative data from three independent experiments are presented as means ± s.e.m. Source data are provided as a file.
Article Snippet: B2m guide RNA was constructed into lentiCRISPR v2 (Addgene #52961) with a targeting sequence of AGTATACTCACGCCACCCACCGG, and a non-targeting sequence of GTATTACTGATATTGGTGGG was set as control.
Techniques: Expressing, Derivative Assay, Cell Culture, Vaccines
